Skip to main content
Addgene

pX335 HTT sgRNA-a
(Plasmid #87201)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87201 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pX335 (Addgene #42335)
  • Total vector size (bp) 8437
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HTT
  • gRNA/shRNA sequence
    GACCCTGGAAAAGCTGATGA
  • Species
    H. sapiens (human)
  • Entrez Gene
    HTT (a.k.a. HD, IT15, LOMARS)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning) (unknown if destroyed)
  • 3′ cloning site BbsI (destroyed during cloning) (unknown if destroyed)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATT
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX335 HTT sgRNA-a was a gift from Mahmoud Pouladi (Addgene plasmid # 87201 ; http://n2t.net/addgene:87201 ; RRID:Addgene_87201)

  • For your References section:

    Reversal of Phenotypic Abnormalities by CRISPR/Cas9-Mediated Gene Correction in Huntington Disease Patient-Derived Induced Pluripotent Stem Cells. Xu X, Tay Y, Sim B, Yoon SI, Huang Y, Ooi J, Utami KH, Ziaei A, Ng B, Radulescu C, Low D, Ng AY, Loh M, Venkatesh B, Ginhoux F, Augustine GJ, Pouladi MA. Stem Cell Reports. 2017 Feb 21. pii: S2213-6711(17)30038-3. doi: 10.1016/j.stemcr.2017.01.022. 10.1016/j.stemcr.2017.01.022 PubMed 28238795
Related items:
Commonly requested with: