p-715MRPprom-MRPcucuc
(Plasmid
#87199)
-
PurposeExpression of ectopic mutated human MRP RNA contstruct from the human RMRP promoter, also contains CMV-puro-t2A-mCherry expression cassette for selection/transfection efficiency
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87199 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepU6
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRMRP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)268
-
MutationGAGAG91-95 to CUCUC
-
Entrez GeneRMRP (a.k.a. CHH, NME1, RMRPR, RRP2)
- Promoter human RMRP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ApaI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer gagatccagtttggttagtacc
- 3′ sequencing primer ataaccgtattaccgccatgcat (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p-715MRPprom-MRPcucuc was a gift from Thomas Cech (Addgene plasmid # 87199 ; http://n2t.net/addgene:87199 ; RRID:Addgene_87199) -
For your References section:
Targeted CRISPR disruption reveals a role for RNase MRP RNA in human preribosomal RNA processing. Goldfarb KC, Cech TR. Genes Dev. 2017 Jan 1;31(1):59-71. doi: 10.1101/gad.286963.116. Epub 2017 Jan 23. 10.1101/gad.286963.116 PubMed 28115465