Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AtFLS2pro::GUS
(Plasmid #87167)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87167 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAMBIA2300
  • Selectable markers
    kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    AT5G46330 promoter
  • Alt name
    FLAGELLIN-SENSITIVE 2
  • Species
    A. thaliana (mustard weed)
  • Promoter AtFLS2
  • Tag / Fusion Protein
    • GUS

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer ttcatctttattttaaaatc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AtFLS2pro::GUS was a gift from Silke Robatzek (Addgene plasmid # 87167 ; http://n2t.net/addgene:87167 ; RRID:Addgene_87167)
  • For your References section:

    Expression patterns of flagellin sensing 2 map to bacterial entry sites in plant shoots and roots. Beck M, Wyrsch I, Strutt J, Wimalasekera R, Webb A, Boller T, Robatzek S. J Exp Bot. 2014 Dec;65(22):6487-98. doi: 10.1093/jxb/eru366. Epub 2014 Sep 9. 10.1093/jxb/eru366 PubMed 25205577