pEFIRES-P-mTagBFP-KDEL
(Plasmid #87163)

• Purpose: Fluorescent marker of endoplasmic reticulum (ER)
• Depositing Lab: Elina Ikonen
• Publication: Salo et al EMBO J. 2016 Dec 15;35(24):2699-2716. Epub 2016 Nov 22.

Backbone

• Vector backbone: pEFIRES-P
• Backbone size w/o insert (bp): 5689
• Total vector size (bp): 6454
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mTagBFP-KDEL
• Species: Synthetic
• Insert Size (bp): 765
• Promoter: EF-1 alpha
• Tags / Fusion Proteins:
  • Bip signal peptide (Homo sapiens) (N terminal on insert)
  • mTagBFP-KDEL (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: XhoI (destroyed during cloning)
• 5′ sequencing primer: pEF-forward tctctccacaggtgtccact
• 3′ sequencing primer: pEF-rev acaccggccttattccaagc

Resource Information

• Supplemental Documents:
  • pEFIRES-P-mTagBFP-KDEL 589E.gb
• A portion of this plasmid was derived from a plasmid made by: mTagBFP-KDEL from addgene plasmid #49150 (BFP-KDEL)
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This vector was generated by Simon Pfisterer (Elina Ikonen Lab).

The BFP-KDEL derived from addgene plasmid #49150 was transferred to pEFIRES-P vector to facilitate the selection of stable mammalian cell lines.

Benefits of using pEFIRES-P vector for stable overexpression in mammalian cells were described by Stephen Hobbs et al. (Biochem Biophys Res Commun. 1998 Nov 18;252(2):368-72.).

pEFIRES-P was a gift from Dr. Olli Ritvos (University of Helsinki).