Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEFIRES-P-mTagBFP-KDEL
(Plasmid #87163)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87163 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEFIRES-P
  • Backbone size w/o insert (bp) 5689
  • Total vector size (bp) 6454
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mTagBFP-KDEL
  • Species
    Synthetic
  • Insert Size (bp)
    765
  • Promoter EF-1 alpha
  • Tags / Fusion Proteins
    • Bip signal peptide (Homo sapiens) (N terminal on insert)
    • mTagBFP-KDEL (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (destroyed during cloning)
  • 5′ sequencing primer pEF-forward tctctccacaggtgtccact
  • 3′ sequencing primer pEF-rev acaccggccttattccaagc
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    mTagBFP-KDEL from addgene plasmid #49150 (BFP-KDEL)
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This vector was generated by Simon Pfisterer (Elina Ikonen Lab).

The BFP-KDEL derived from addgene plasmid #49150 was transferred to pEFIRES-P vector to facilitate the selection of stable mammalian cell lines.

Benefits of using pEFIRES-P vector for stable overexpression in mammalian cells were described by Stephen Hobbs et al. (Biochem Biophys Res Commun. 1998 Nov 18;252(2):368-72.).

pEFIRES-P was a gift from Dr. Olli Ritvos (University of Helsinki).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEFIRES-P-mTagBFP-KDEL was a gift from Elina Ikonen (Addgene plasmid # 87163 ; http://n2t.net/addgene:87163 ; RRID:Addgene_87163)
  • For your References section:

    Seipin regulates ER-lipid droplet contacts and cargo delivery. Salo VT, Belevich I, Li S, Karhinen L, Vihinen H, Vigouroux C, Magre J, Thiele C, Holtta-Vuori M, Jokitalo E, Ikonen E. EMBO J. 2016 Dec 15;35(24):2699-2716. Epub 2016 Nov 22. 10.15252/embj.201695170 PubMed 27879284