pEFIRES-P-EGFP-ADRP
(Plasmid #87157)

• Purpose: Fluorescent protein localized to lipid droplets (LDs)
• Depositing Lab: Elina Ikonen
• Publication: Salo et al EMBO J. 2016 Dec 15;35(24):2699-2716. Epub 2016 Nov 22.

Backbone

• Vector backbone: pEFIRES-P
• Backbone size w/o insert (bp): 5689
• Total vector size (bp): 6571
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ADRP
• Alt name: PLIN2
• Species: H. sapiens (human)
• Insert Size (bp): 1314
• GenBank ID: BC005127.2
• Entrez Gene: PLIN2 (a.k.a. ADFP, ADRP)
• Promoter: mCherry-R TTGGTCACCTTCAGCTTGG
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: EGFP-C-F catggtcctgctggagttcgtg
• 3′ sequencing primer: pEF-rev acaccggccttattccaagc

Resource Information

• Supplemental Documents:
  • pEFIRES-P-EGFP-ADRP 643E.gb
• A portion of this plasmid was derived from a plasmid made by: ADRP cDNA from Open Biosystems (Clone ID:3844174)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This vector was generated by Simon Pfisterer and Shiqian Li (Elina Ikonen Lab).

Benefits of using pEFIRES-P vector for stable overexpression in mammalian cells were described by Stephen Hobbs et al. (Biochem Biophys Res Commun. 1998 Nov 18;252(2):368-72.).

pEFIRES-P was a gift from Dr. Olli Ritvos (University of Helsinki).