Tubb3gRNA-mCherry
(Plasmid
#87111)
-
Purposemouse Tubb3 target gRNA expression plasmid with CAGmCherry
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87111 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAGmCherry-gRNA
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMouse Tubb3 gRNA
-
gRNA/shRNA sequenceGGCTGCGAGCAACTTCACTT
-
SpeciesSynthetic
- Promoter CAG
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer pCAG-F (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tubb3gRNA-mCherry was a gift from Juan Belmonte (Addgene plasmid # 87111 ; http://n2t.net/addgene:87111 ; RRID:Addgene_87111) -
For your References section:
In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Suzuki K, Tsunekawa Y, Hernandez-Benitez R, Wu J, Zhu J, Kim EJ, Hatanaka F, Yamamoto M, Araoka T, Li Z, Kurita M, Hishida T, Li M, Aizawa E, Guo S, Chen S, Goebl A, Soligalla RD, Qu J, Jiang T, Fu X, Jafari M, Esteban CR, Berggren WT, Lajara J, Nunez-Delicado E, Guillen P, Campistol JM, Matsuzaki F, Liu GH, Magistretti P, Zhang K, Callaway EM, Zhang K, Belmonte JC. Nature. 2016 Dec 1;540(7631):144-149. doi: 10.1038/nature20565. Epub 2016 Nov 16. 10.1038/nature20565 PubMed 27851729