plc242-GFP-WDR24
(Plasmid
#87050)
-
Purposemammalian expression of WDR24
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87050 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneplc242
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameWDR24
-
Alt nameNM_032259
-
SpeciesH. sapiens (human)
-
Entrez GeneWDR24 (a.k.a. LA16c-313D11.2, C16orf21, JFP7)
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer GGCATGGACGAGCTGTACAAG
- 3′ sequencing primer GCATTCATTTTATGTTTCAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
plc242-GFP-WDR24 was a gift from David Sabatini (Addgene plasmid # 87050 ; http://n2t.net/addgene:87050 ; RRID:Addgene_87050) -
For your References section:
KICSTOR recruits GATOR1 to the lysosome and is necessary for nutrients to regulate mTORC1. Wolfson RL, Chantranupong L, Wyant GA, Gu X, Orozco JM, Shen K, Condon KJ, Petri S, Kedir J, Scaria SM, Abu-Remaileh M, Frankel WN, Sabatini DM. Nature. 2017 Feb 15. doi: 10.1038/nature21423. 10.1038/nature21423 PubMed 28199306