Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

HS-H3.3A d436-GFP
(Plasmid #8697)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 8697 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    na
  • Backbone size w/o insert (bp) 10200
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    H3.3A truncated
  • Alt name
    H3.3^core
  • Alt name
    His3.3A
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    315
  • Mutation
    Deletion of amino acids 4-36.
  • Entrez Gene
    His3.3A (a.k.a. Dmel_CG5825, CG5825, Dmel\CG5825, H3.3, H3.3A, His-3.3A, His3.3, PH3, dH3.3A)
  • Tag / Fusion Protein
    • GFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site EagI (not destroyed)
  • 5′ sequencing primer na
  • 3′ sequencing primer CCATCTAATTCAACAAGAATTGGGACAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Same as H3.3^core. Ahmad lab #k58.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HS-H3.3A d436-GFP was a gift from Kami Ahmad (Addgene plasmid # 8697 ; http://n2t.net/addgene:8697 ; RRID:Addgene_8697)
  • For your References section:

    The histone variant H3.3 marks active chromatin by replication-independent nucleosome assembly. Ahmad K, Henikoff S. Mol Cell 2002 Jun;9(6):1191-200. 10.1016/S1097-2765(02)00542-7 PubMed 12086617