pET tdTomato LIC cloning vector (u-tdTomato)
(Plasmid #86926)

• Purpose: (Empty Backbone) pET LIC cloning vector for yORF-tdTomato
• Depositing Lab: Chris Jeans
• Publication: C-terminal fluorescent fusion vectors for E. coli expression (unpublished)

Backbone

• Vector backbone: pET
• Backbone size (bp): 6192
• Modifications to backbone: tdTomato is from AddGene plasmid 62726.
• Vector type: Bacterial Expression
• Promoter: T7
• Tag / Fusion Protein:
  • tdTomato (C terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: T7 Forward
• 3′ sequencing primer: T7 Reverse

Resource Information

• Supplemental Documents:
  • u-tdTomato.gb
• A portion of this plasmid was derived from a plasmid made by: The sequence for tdTomato came from Addgene #62726 (pAAV-Syn-Chronos-tdTomato).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. This plasmid can be used as a single-expression vector, and it is also compatible with our 2-series polycistronic destination vectors (2D, 2E, and 2Z), if co-expression with other genes is desired.

To clone into this vector, add LIC tags to the 5' end of your PCR primers.

Forward - 5' TTTAAGAAGGAGATATAGATC3'

Reverse - 5' GTTGGAGGATGAGAGGATCCC 3'

You MUST include a start ATG in your ORF. Do NOT include a stop codon with your reverse primer.

Linearize the plasmid with EcoRV, then gel purify.

When digesting the DNA with T4 polymerase, use dGTP for the insert and dCTP for your linearized vector.

More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/