HUWE1-sgRNA-1
(Plasmid
#86924)
-
PurposeTo express sgRNA target HUWE1 gene
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86924 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX330-U6-Chimeric_BB-CBh-hSpCas9(D10A)
-
Modifications to backboneMutation D10A was introduced into the Cas9 sequence to generate a Cas9 nickase mutant.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHUWE1 sgRNA1
-
Alt nameHUWE1 sgRNA1 "ATACACCTACTCCCCGATTC"
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
-
GenBank IDNM_031407.6
-
Entrez GeneHUWE1 (a.k.a. ARF-BP1, HECTH9, HSPC272, Ib772, LASU1, MRXST, MULE, URE-B1, UREB1)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (not destroyed)
- 3′ cloning site BbsI (not destroyed)
- 5′ sequencing primer CAAGGCTGTTAGAGAGATAATTGGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HUWE1-sgRNA-1 was a gift from Yihong Ye (Addgene plasmid # 86924 ; http://n2t.net/addgene:86924 ; RRID:Addgene_86924) -
For your References section:
The HECT domain ubiquitin ligase HUWE1 targets unassembled soluble proteins for degradation. Xu Y, Anderson DE, Ye Y. Cell Discov. 2016 Nov 8;2:16040. eCollection 2016. 10.1038/celldisc.2016.40 PubMed 27867533