ER-GCaMP6-150
(Plasmid #86918)

• Purpose: Fluorescent reporter for ER calcium signaling
• Depositing Lab: Timothy Ryan
• Publication: de Juan-Sanz et al Neuron. 2017 Jan 30. pii: S0896-6273(17)30034-X. doi: 10.1016/j.neuron.2017.01.010.

Backbone

• Vector backbone: FCK(1.3)GW
• Backbone size w/o insert (bp): 9246
• Total vector size (bp): 10698
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Zeo marker is outside the LTRs and will not be packaged into virus.

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ER-GCaMP6-150
• Species: Synthetic
• Insert Size (bp): 1452
• Mutation: K78H, T302L, R303P, A317E, D324G, D360G, D380Y, T381R, S383T, R392G in GCaMP3
• Promoter: CAMKII

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: atgactgagaccctcccacccgtg actgaaagcgccgt

Resource Information

• Supplemental Documents:
  • CamKII_ER-GCaMP6-150.gb
• Articles Citing this Plasmid:
  • 15 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry