-
PurposeFluorescent reporter for ER calcium signaling
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86918 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneFCK(1.3)GW
- Backbone size w/o insert (bp) 9246
- Total vector size (bp) 10698
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersZeo marker is outside the LTRs and will not be packaged into virus.
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameER-GCaMP6-150
-
SpeciesSynthetic
-
Insert Size (bp)1452
-
MutationK78H, T302L, R303P, A317E, D324G, D360G, D380Y, T381R, S383T, R392G in GCaMP3
- Promoter CAMKII
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer atgactgagaccctcccacccgtg actgaaagcgccgt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ER-GCaMP6-150 was a gift from Timothy Ryan (Addgene plasmid # 86918 ; http://n2t.net/addgene:86918 ; RRID:Addgene_86918) -
For your References section:
Axonal Endoplasmic Reticulum Ca2+ Content Controls Release Probability in CNS Nerve Terminals. de Juan-Sanz J, Holt GT, Schreiter ER, de Juan F, Kim DS, Ryan TA. Neuron. 2017 Jan 30. pii: S0896-6273(17)30034-X. doi: 10.1016/j.neuron.2017.01.010. 10.1016/j.neuron.2017.01.010 PubMed 28162809