pPotef-LN22*-3xGNLS-cbx
(Plasmid #86780)

• Purpose: Expresses lambda N protein fused to triple Gfp coupled to an NLS sequence under the control of the constitutively active Potef promotor.
• Depositing Lab: Michael Feldbrügge
• Publication: Pohlmann et al Elife. 2015 May 18;4. doi: 10.7554/eLife.06041.

Backbone

• Vector backbone: pUC57
• Total vector size (bp): 7896
• Vector type: Bacterial Expression ; Ustilago maydis Expression
• Selectable markers: Carboxine

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LN*
• Alt name: lambdaN
• Species: Phage
• Insert Size (bp): 69
• Promoter: Potef
• Tag / Fusion Protein:
  • Gfp (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: BamHI (unknown if destroyed)
• 5′ sequencing primer: TCCAATAAAGGGCGCTGTCTCGGC
• 3′ sequencing primer: TGTGGCCGTTTACGTCGC

Resource Information

• Supplemental Documents:
  • pUMa 1597.gbk
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry