pUB-Cas9-@GL1
(Plasmid
#86779)
-
PurposeDisruption of GLABROUS1 gene in Arabidopsis using CRISPR/Cas9
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86779 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUB-Cas9
-
Backbone manufacturerHahn et al., 2017
- Backbone size w/o insert (bp) 14121
- Total vector size (bp) 14834
-
Modifications to backboneIntroduction of U6-26p::sgRNA
-
Vector typePlant Expression, Synthetic Biology
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA against GLABROUS1
-
SpeciesSynthetic
-
Insert Size (bp)735
- Promoter Arabidopsis U6-26 promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gtaaaacgacggccag
- 3′ sequencing primer TATTACTGACTCGTCGGGTA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPeter Hegemann (HU Berlin)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Generates mutations in GLABROUS1 gene, resulting in trichomeless Arabidopsis leaf phenotype (see Hahn et al., 2017)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUB-Cas9-@GL1 was a gift from Andreas Weber (Addgene plasmid # 86779 ; http://n2t.net/addgene:86779 ; RRID:Addgene_86779) -
For your References section:
An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana. Hahn F, Mantegazza O, Greiner A, Hegemann P, Eisenhut M, Weber AP. Front Plant Sci. 2017 Jan 24;8:39. doi: 10.3389/fpls.2017.00039. eCollection 2017. 10.3389/fpls.2017.00039 PubMed 28174584