pUB-Cas9-@GL1
(Plasmid #86779)

• Purpose: Disruption of GLABROUS1 gene in Arabidopsis using CRISPR/Cas9
• Depositing Lab: Andreas Weber
• Publication: Hahn et al Front Plant Sci. 2017 Jan 24;8:39. doi: 10.3389/fpls.2017.00039. eCollection 2017.

Backbone

• Vector backbone: pUB-Cas9
• Backbone manufacturer: Hahn et al., 2017
• Backbone size w/o insert (bp): 14121
• Total vector size (bp): 14834
• Modifications to backbone: Introduction of U6-26p::sgRNA
• Vector type: Plant Expression, Synthetic Biology
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: sgRNA against GLABROUS1
• Species: Synthetic
• Insert Size (bp): 735
• Promoter: Arabidopsis U6-26 promoter

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gtaaaacgacggccag
• 3′ sequencing primer: TATTACTGACTCGTCGGGTA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Peter Hegemann (HU Berlin)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Generates mutations in GLABROUS1 gene, resulting in trichomeless Arabidopsis leaf phenotype (see Hahn et al., 2017)