Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pL2020
(Plasmid #86709)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86709 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBBR
  • Backbone size (bp) 5328
  • Modifications to backbone
    MCS with N- and C-terminal His10 tag
  • Vector type
    Bacterial Expression
  • Promoter araBAD
  • Tags / Fusion Proteins
    • His10 tag (N terminal on backbone)
    • His10 tag (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    no special handling required
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer AGATTAGCGGATCCTACCTG
  • 3′ sequencing primer CAGACCGCTTCTGCGTTCTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pL2020 was a gift from Hartmut Michel (Addgene plasmid # 86709 ; http://n2t.net/addgene:86709 ; RRID:Addgene_86709)
  • For your References section:

    Pseudomonas stutzeri as an alternative host for membrane proteins. Sommer M, Xie H, Michel H. Microb Cell Fact. 2017 Sep 20;16(1):157. doi: 10.1186/s12934-017-0771-0. 10.1186/s12934-017-0771-0 [pii] PubMed 28931397