pL2020
(Plasmid
#86709)
-
Purpose(Empty Backbone) araBAD based expression vector for inducible protein production in bacterial hosts
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86709 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepBBR
- Backbone size (bp) 5328
-
Modifications to backboneMCS with N- and C-terminal His10 tag
-
Vector typeBacterial Expression
- Promoter araBAD
-
Tags
/ Fusion Proteins
- His10 tag (N terminal on backbone)
- His10 tag (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsno special handling required
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer AGATTAGCGGATCCTACCTG
- 3′ sequencing primer CAGACCGCTTCTGCGTTCTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pL2020 was a gift from Hartmut Michel (Addgene plasmid # 86709 ; http://n2t.net/addgene:86709 ; RRID:Addgene_86709) -
For your References section:
Pseudomonas stutzeri as an alternative host for membrane proteins. Sommer M, Xie H, Michel H. Microb Cell Fact. 2017 Sep 20;16(1):157. doi: 10.1186/s12934-017-0771-0. 10.1186/s12934-017-0771-0 [pii] PubMed 28931397
Map uploaded by the depositor.
