CROPseq-Guide-Puro
(Plasmid #86708)

• Purpose: Makes CRISPR gRNAs detectable by single-cell RNA-seq. The gRNA is expressed as part of the puromycin resistance mRNA transcribed by RNA Pol II and in its functional form from the hU6 promoter.
• Depositing Lab: Christoph Bock
• Publication: Datlinger et al Nat Methods. 2017 Jan 18. doi: 10.1038/nmeth.4177.

Backbone

• Vector backbone: lentiGuide-Puro
• Backbone manufacturer: Feng Zhang Lab
• Total vector size (bp): 10214
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EF1a-Puro-WPRE-hU6-gRNA
• gRNA/shRNA sequence: replace filler with custom gRNA sequence or library
• Species: Synthetic
• Promoter: hU6

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TTGGGCACTGACAATTCCGT

Resource Information

• Supplemental Documents:
  • CROPseq-Guide-Puro-Genbank
• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 33 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please see CROP-seq supplementary website for protocols, data archives and related software at: http://www.medical-epigenomics.org/papers/datlinger2017/