pAAV-Neo_CAG-Cas9
(Plasmid #86698)

• Purpose: Cas9 expression vector for targeting to the AAVS1 locus
• Depositing Lab: Ludovic Vallier
• Publication: Bertero et al Development. 2016 Dec 1;143(23):4405-4418.

Backbone

• Vector backbone: AAVS1-SA-2A-NEO-CAG-RTTA3 Addgene 60431
• Backbone manufacturer: Paul Gadue
• Backbone size w/o insert (bp): 9453
• Total vector size (bp): 13554
• Modifications to backbone: RTTA3 was removed by digestion with MluI and AflII
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cas9
• Insert Size (bp): 4101
• Promoter: pCag

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: AflII (not destroyed)
• 5′ sequencing primer: TACAGCTCCTGGGCAACGTG

Resource Information

• Supplemental Documents:
  • AAVS1_Neo_pCAG_WTCas9seq.gb
• A portion of this plasmid was derived from a plasmid made by: Cas9 gene was amplified from addgene plasmid 62988
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry