pAAV-Puro_siKO
(Plasmid #86696)

• Purpose: (Empty Backbone) Tetracycline inducible expression of guide RNA targeted to AAVS1 locus
• Depositing Lab: Ludovic Vallier
• Publication: Bertero et al Development. 2016 Dec 1;143(23):4405-4418.

Backbone

• Vector backbone: pAAV-Puro_siKD
• Backbone manufacturer: Ludovic Vallier
• Backbone size (bp): 9585
• Modifications to backbone: AarI site removed, Guide RNA scaffold added after the H1TO promoter.
• Vector type: Mammalian Expression, CRISPR
• Promoter: H1 TO
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: CGAACGCTGACGTCATCAACC
• 3′ sequencing primer: GGGCTATGAACTAATGACCCCG

Resource Information

• Supplemental Documents:
  • pAAV-Puro_siKOseq.gb
• A portion of this plasmid was derived from a plasmid made by: H1-TO promoter taken from pSuperior Neo (oligoengine)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry