pHAGE2 Lnp-mCherry
(Plasmid #86687)

• Purpose: Lentivirus to stably express fluorescent human protein in mammalian cells
• Depositing Lab: Tom Rapoport
• Publication: Wang et al Elife. 2016 Sep 13;5. pii: e18605. doi: 10.7554/eLife.18605.

Backbone

• Vector backbone: pHAGE2 GFP N-terminal
• Backbone size w/o insert (bp): 7700
• Total vector size (bp): 9816
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LNPK
• Species: H. sapiens (human)
• Insert Size (bp): 2076
• Entrez Gene: LNPK (a.k.a. KIAA1715, LNP, LNP1, NEDEHCC, Ul, ulnaless)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PacI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GGTCTATATAAGCAGAGCTCG
• 3′ sequencing primer: CATATAGACAAACGCACACC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Yoko Shibata
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry