pHAGE2 mCherry-Rtn4a
(Plasmid #86683)

• Purpose: Lentivirus to stably express fluorescent human protein in mammalian cells
• Depositing Lab: Tom Rapoport
• Publication: Wang et al Elife. 2016 Sep 13;5. pii: e18605. doi: 10.7554/eLife.18605.

Backbone

• Vector backbone: pHAGE2 mCherry N-terminal
• Backbone size w/o insert (bp): 8200
• Total vector size (bp): 11809
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Rtn4a
• Species: H. sapiens (human)
• Insert Size (bp): 3576
• Entrez Gene: RTN4 (a.k.a. ASY, NI220/250, NOGO, NSP, NSP-CL, Nbla00271, Nbla10545, RTN-X, RTN4-A, RTN4-B1, RTN4-B2, RTN4-C)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GGTCTATATAAGCAGAGCTCG
• 3′ sequencing primer: CATATAGACAAACGCACACC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Yoko Shibata
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene NGS results found P122Q and P145T within the Rtn4a translation compared to NP_065393.1.