pHAGE2 mCherry-Atl3
(Plasmid #86680)

• Purpose: Lentivirus to stably express fluorescent protein in mammalian cells
• Depositing Lab: Tom Rapoport
• Publication: Wang et al Elife. 2016 Sep 13;5. pii: e18605. doi: 10.7554/eLife.18605.

Backbone

• Vector backbone: pHAGE2 mCherry N-terminal
• Backbone size w/o insert (bp): 8200
• Total vector size (bp): 9907
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ATL3
• Species: H. sapiens (human)
• Insert Size (bp): 1623
• Entrez Gene: ATL3 (a.k.a. HSN1F)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GGTCTATATAAGCAGAGCTCG
• 3′ sequencing primer: CATATAGACAAACGCACACC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Yoko Shibata
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry