Skip to main content
Addgene

CANE-LV envelope
(Plasmid #86666)

Print

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 86666 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCASGS/ES
  • Backbone size w/o insert (bp) 4821
  • Total vector size (bp) 7919
  • Modifications to backbone
    add WPRE to the 3' of the insert
  • Vector type
    Mammalian Expression, Mouse Targeting, Lentiviral, Synthetic Biology
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CANE-LV envelope
  • Alt name
    M21EnvA-VSVg
  • Species
    Synthetic
  • Insert Size (bp)
    1919
  • GenBank ID
    KX990266.1
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer cttcttctttttcctacagc
  • 3′ sequencing primer tttcacaaattttgtaatcc
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CANE-LV envelope was a gift from Fan Wang (Addgene plasmid # 86666 ; http://n2t.net/addgene:86666 ; RRID:Addgene_86666)

  • For your References section:

    Capturing and Manipulating Activated Neuronal Ensembles with CANE Delineates a Hypothalamic Social-Fear Circuit. Sakurai K, Zhao S, Takatoh J, Rodriguez E, Lu J, Leavitt AD, Fu M, Han BX, Wang F. Neuron. 2016 Nov 23;92(4):739-753. doi: 10.1016/j.neuron.2016.10.015. Epub 2016 Oct 27. 10.1016/j.neuron.2016.10.015 PubMed 27974160
Related items:
Commonly requested with: