Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

alpha7-nAChR(scramble control)
(Plasmid #86649)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 86649 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSuper
  • Vector type
    Mammalian Expression, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CHRNA7 (control)
  • gRNA/shRNA sequence
    GCTCCTCATATATCATCAATA
  • Species
    H. sapiens (human)
  • Promoter H1

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    alpha7-nAChR(scramble control) was a gift from Jaime Modiano (Addgene plasmid # 86649 ; http://n2t.net/addgene:86649 ; RRID:Addgene_86649)
  • For your References section:

    Nicotine-mediated signals modulate cell death and survival of T lymphocytes. Oloris SC, Frazer-Abel AA, Jubala CM, Fosmire SP, Helm KM, Robinson SR, Korpela DM, Duckett MM, Baksh S, Modiano JF. Toxicol Appl Pharmacol. 2010 Feb 1;242(3):299-309. doi: 10.1016/j.taap.2009.10.020. Epub 2009 Nov 4. 10.1016/j.taap.2009.10.020 PubMed 19896492