Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHR-FKBP:mCherry-Rab7a
(Plasmid #86638)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 86638 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHR
  • Backbone size w/o insert (bp) 8912
  • Total vector size (bp) 10638
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FKBP-mCherry-Rab7a
  • Insert Size (bp)
    1728

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer gcttcccgagctctataaaagagc
  • 3′ sequencing primer ccagaggttgattatcgataagc
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-FKBP:mCherry-Rab7a was a gift from Thomas Leonard & Ivan Yudushkin (Addgene plasmid # 86638 ; http://n2t.net/addgene:86638 ; RRID:Addgene_86638)
  • For your References section:

    PI(3,4,5)P3 Engagement Restricts Akt Activity to Cellular Membranes. Ebner M, Lucic I, Leonard TA, Yudushkin I. Mol Cell. 2017 Feb 2;65(3):416-431.e6. doi: 10.1016/j.molcel.2016.12.028. 10.1016/j.molcel.2016.12.028 PubMed 28157504