pY036_ATP1A1_G5_Array
(Plasmid #86620)

• Purpose: Vector for expression of a CRISPR/AsCpf1 array containing the ATP1A1 G5 guide in combination with a user-specified guide. Cloning of oligos for the second guide using BbsI sites. PY036-like plasmid
• Depositing Lab: Yannick Doyon
• Publication: Agudelo et al Nat Methods. 2017 Apr 17. doi: 10.1038/nmeth.4265.

Backbone

• Vector backbone: pY036-U6-crRNA(BbsI)-CBh-AsCpf1
• Total vector size (bp): 8507
• Vector type: Mammalian Expression, CRISPR ; Co-selection via HDR using ouabain

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: ATP1A1 G5 crRNA + user-specified crRNA + AsCpf1-3xHA
• Alt name: hAsCpf1
• Alt name: Cpf1
• Species: Acidaminococcus_sp_BV3L6
• Insert Size (bp): 8507
• Promoter: CBh
• Tag / Fusion Protein:
  • 3xHA (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: agggatggttggttggtggg
• 3′ sequencing primer: CCAATCCTCCCCCTTGCTGT

Resource Information

• Supplemental Documents:
  • pY036_ATP1A1_G5_Array.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry