eSpCas9(1.1)_No_FLAG_ATP1A1_G2_Dual_sgRNA
(Plasmid #86612)

• Purpose: Vector for tandem expression of ATP1A1 G2 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos for second sgRNA using BbsI sites. Px333-like plasmid
• Depositing Lab: Yannick Doyon
• Publication: Agudelo et al Nat Methods. 2017 Apr 17. doi: 10.1038/nmeth.4265.

Backbone

• Vector backbone: pX330-U6-Chimeric_BB-CBh-hSpCas9
• Total vector size (bp): 8858
• Vector type: Mammalian Expression, CRISPR ; Co-selection via NHEJ using ouabain

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ATP1A1 G2 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
• Alt name: eSpCas9(1.1)_No_FLAG
• Species: S. pyogenes
• Insert Size (bp): 8858
• Mutation: K848A, K1003A, & R1060A
• Promoter: CBh

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GCAGACAAATGGCTCTAGCTG
• 3′ sequencing primer: CAGCTAGAGCCATTTGTCTGC

Resource Information

• Supplemental Documents:
  • eSpCas9(1.1)_No_FLAG_ATP1A1_G2_Dual_sgRNA.gb
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

ATP1A1 G2 gRNA target sequence is gatccaagctgctacagaag.