Skip to main content
Addgene

eSpCas9(1.1)_No_FLAG_ATP1A1_G3
(Plasmid #86611)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86611 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pX330-U6-Chimeric_BB-CBh-hSpCas9
  • Total vector size (bp) 8439
  • Vector type
    Mammalian Expression, CRISPR ; Co-selection via HDR using ouabain

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATP1A1 G3 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
  • Alt name
    eSpCas9(1.1)_No_FLAG
  • Species
    S. pyogenes
  • Insert Size (bp)
    8439
  • Mutation
    K848A, K1003A, & R1060A
  • Promoter CBh

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer agggatggttggttggtggg
  • 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    eSpCas9(1.1)_No_FLAG_ATP1A1_G3 was a gift from Yannick Doyon (Addgene plasmid # 86611 ; http://n2t.net/addgene:86611 ; RRID:Addgene_86611)
  • For your References section:

    Marker-free coselection for CRISPR-driven genome editing in human cells. Agudelo D, Duringer A, Bozoyan L, Huard CC, Carter S, Loehr J, Synodinou D, Drouin M, Salsman J, Dellaire G, Laganiere J, Doyon Y. Nat Methods. 2017 Apr 17. doi: 10.1038/nmeth.4265. 10.1038/nmeth.4265 PubMed 28417998