eSpCas9(1.1)_No_FLAG_ATP1A1_G2
(Plasmid #86610)

• Purpose: Expresses the ATP1A1 G2 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 exon 4. Px330-like plasmid
• Depositing Lab: Yannick Doyon
• Publication: Agudelo et al Nat Methods. 2017 Apr 17. doi: 10.1038/nmeth.4265.

Backbone

• Vector backbone: pX330-U6-Chimeric_BB-CBh-hSpCas9
• Total vector size (bp): 8439
• Vector type: Mammalian Expression, CRISPR ; Co-selection via NHEJ using ouabain

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ATP1A1 G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
• Alt name: eSpCas9(1.1)_No_FLAG
• Species: S. pyogenes
• Insert Size (bp): 8439
• Mutation: K848A, K1003A, & R1060A
• Promoter: CBh

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: agggatggttggttggtggg
• 3′ sequencing primer: CCAATCCTCCCCCTTGCTGT

Resource Information

• Supplemental Documents:
  • eSpCas9(1.1)_No_FLAG_ATP1A1_G2.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

gRNA target sequence is gatccaagctgctacagaag.