AAV9:cTNT::3Flag-hYAP S127A
(Plasmid #86558)

• Purpose: To produce cardiac specific adeno-associated virus expressing activated human YAP.
• Depositing Lab: William Pu
• Publication: Lin et al Circ Res. 2014 Jul 18;115(3):354-63. doi: 10.1161/CIRCRESAHA.115.303632. Epub 2014 May 15.

Backbone

• Vector backbone: pAAV.cTNT.
• Backbone manufacturer: Upen vector core
• Modifications to backbone: None
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: YAP
• Alt name: Yes associated protein 1
• Species: H. sapiens (human)
• Insert Size (bp): 1548
• Mutation: Serine 127 was mutated into Alanine, to activate YAP.
• GenBank ID: NP_001181973.1 NM_001130145.2
• Entrez Gene: YAP1 (a.k.a. COB1, YAP, YAP-1, YAP2, YAP65, YKI)
• Promoter: cTNT
• Tag / Fusion Protein:
  • 3Flag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CCAATAGAAACTGGGCTTGTC
• 3′ sequencing primer: CCAGAAGTCAGATGCTCAAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The YAP gene CDS was originally from Fernando Camargo lab, Boston Children's Hospital
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

After plasmid preparation, a SmaI diagnose digestion is necessary to confirm if there any mutation in the ITR regions.