Skip to main content
Addgene

AAV9:cTNT::3Flag-hYAP S127A
(Plasmid #86558)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86558 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV.cTNT.
  • Backbone manufacturer
    Upen vector core
  • Modifications to backbone
    None
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    YAP
  • Alt name
    Yes associated protein 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1548
  • Mutation
    Serine 127 was mutated into Alanine, to activate YAP.
  • GenBank ID
    NP_001181973.1 NM_001130145.2
  • Entrez Gene
    YAP1 (a.k.a. COB1, YAP, YAP-1, YAP2, YAP65, YKI)
  • Promoter cTNT
  • Tag / Fusion Protein
    • 3Flag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CCAATAGAAACTGGGCTTGTC
  • 3′ sequencing primer CCAGAAGTCAGATGCTCAAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The YAP gene CDS was originally from Fernando Camargo lab, Boston Children's Hospital
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

After plasmid preparation, a SmaI diagnose digestion is necessary to confirm if there any mutation in the ITR regions.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV9:cTNT::3Flag-hYAP S127A was a gift from William Pu (Addgene plasmid # 86558 ; http://n2t.net/addgene:86558 ; RRID:Addgene_86558)
  • For your References section:

    Cardiac-specific YAP activation improves cardiac function and survival in an experimental murine MI model. Lin Z, von Gise A, Zhou P, Gu F, Ma Q, Jiang J, Yau AL, Buck JN, Gouin KA, van Gorp PR, Zhou B, Chen J, Seidman JG, Wang DZ, Pu WT. Circ Res. 2014 Jul 18;115(3):354-63. doi: 10.1161/CIRCRESAHA.115.303632. Epub 2014 May 15. 10.1161/CIRCRESAHA.115.303632 PubMed 24833660