AAV9:cTNT::3Flag-hYAP S127A
(Plasmid #86558)

• Purpose: To produce cardiac specific adeno-associated virus expressing activated human YAP.
• Depositing Lab: William Pu
• Publication: Lin et al Circ Res. 2014 Jul 18;115(3):354-63. doi: 10.1161/CIRCRESAHA.115.303632. Epub 2014 May 15.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV.cTNT.
• Backbone manufacturer: Upen vector core
• Modifications to backbone: None
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: YAP
• Alt name: Yes associated protein 1
• Species: H. sapiens (human)
• Insert Size (bp): 1548
• Mutation: Serine 127 was mutated into Alanine, to activate YAP.
• GenBank ID: NP_001181973.1 NM_001130145.2
• Entrez Gene: YAP1 (a.k.a. COB1, YAP, YAP-1, YAP2, YAP65, YKI)
• Promoter: cTNT
• Tag / Fusion Protein:
  • 3Flag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CCAATAGAAACTGGGCTTGTC
• 3′ sequencing primer: CCAGAAGTCAGATGCTCAAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The YAP gene CDS was originally from Fernando Camargo lab, Boston Children's Hospital
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

After plasmid preparation, a SmaI diagnose digestion is necessary to confirm if there any mutation in the ITR regions.