pUB-Cas9
(Plasmid #86556)

• Purpose: For ubiquitous expression of Cas9 in planta. sgRNA can be introduced as described in Hahn et al. (2017)
• Depositing Lab: Andreas Weber
• Publication: Hahn et al Front Plant Sci. 2017 Jan 24;8:39. doi: 10.3389/fpls.2017.00039. eCollection 2017.

Backbone

• Vector backbone: pKB65
• Backbone manufacturer: Kristin Bernhardt
• Backbone size w/o insert (bp): 11630
• Total vector size (bp): 14121
• Vector type: Plant Expression, CRISPR
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cas9
• Species: Synthetic
• Insert Size (bp): 4137
• Mutation: Cas9 is codon optimized for C. reinhardtii
• Promoter: UBIQUITIN10

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: TTTCGTTCGATCCCAATTTC
• 3′ sequencing primer: aagaccggcaacaggattc

Resource Information

• Supplemental Documents:
  • CRISPR Protocol
• A portion of this plasmid was derived from a plasmid made by: Peter Hegemann, HU Berlin

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

See Hahn et al., 2017