pAP84
(Plasmid #86554)

• Purpose: Expresses sLucopt luciferase from the constitive Bacillus subtilis promoter Pveg in Clostridium difficile
• Depositing Lab: Wiep Klaas Smits
• Publication: Smits lab Constitutively secreted luciferase plasmid (unpublished)

Backbone

• Vector backbone: pRPF185
• Backbone manufacturer: Robert Fagan and Neil Fairweather
• Backbone size w/o insert (bp): 6378
• Total vector size (bp): 7072
• Modifications to backbone: Cut KnpI, BamHI to remove Ptet-gusA; insertion of Pveg-sLucopt
• Vector type: Bacterial Expression, Luciferase, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Occasional insertions of an IS element commonly found in E.coli cloning strains is observed; the Pveg promoter seems particularly prone to insertions. If problems are encountered, we recommend maintaining the plasmid in, and isolating it from, strains that are negative for this element. By PCR, MC1061 or derivative strains are negative. DH5a or derivatives should be avoided. IS-less cloning strains (such as MDS42) are recommended. Growth on 20ug/mL Cm on plate (E.coli), or 10 ug/mL Cm in liquid culture (E.coli). For C. difficile selection use Thiamphenicol at 15 ug/mL.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Pveg-sLucopt
• Alt name: secreted luciferase expressed from constitutive promoter
• Species: Synthetic; Bacillus subtilis
• Insert Size (bp): 694
• GenBank ID: NC_000964
• Promoter: Pveg

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: NF_793 (CACCTCCTTTTTGACTTTAAGCCTACGAATACC)
• 3′ sequencing primer: NF_794 (CACCGACGAGCAAGGCAAGACCG)

Resource Information

• Supplemental Documents:
  • pAP84 (Addgene).gb
  • Geneious file (sequence and annotation)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • NanoLuc Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the individual components of this construct (that is, Pveg and sLucopt) are described in Oliveira Paiva AM et al (2016) ACS Synth Biol (DOI: 10.1021/acssynbio.6b00104). During the cloning a mutation occurred that removes the SacI site in between the Pveg and sLucopt genes. The 5' (KpnI) and 3' (BamHI) restriction sites remain.