-
PurposeRetrovirus expressing GFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86537 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMSCV
- Backbone size w/o insert (bp) 6181
- Total vector size (bp) 6901
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP
-
SpeciesSynthetic
-
Insert Size (bp)720
- Promoter Synapsin I (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer ACGACGGCAACTACAAGACC
- 3′ sequencing primer AACCAGTGGGGGTTGCGT (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV-GFP was a gift from Xue Han (Addgene plasmid # 86537 ; http://n2t.net/addgene:86537 ; RRID:Addgene_86537) -
For your References section:
Young adult born neurons enhance hippocampal dependent performance via influences on bilateral networks. Zhuo JM, Tseng HA, Desai M, Bucklin ME, Mohammed AI, Robinson NT, Boyden ES, Rangel LM, Jasanoff AP, Gritton HJ, Han X. Elife. 2016 Dec 3;5. pii: e22429. doi: 10.7554/eLife.22429. 10.7554/eLife.22429 PubMed 27914197