pMSCV-ArchT-GFP
(Plasmid #86536)

• Purpose: Retrovirus expressing optogenetic silencer ArchT-GFP
• Depositing Lab: Xue Han
• Publication: Zhuo et al Elife. 2016 Dec 3;5. pii: e22429. doi: 10.7554/eLife.22429.

Backbone

• Vector backbone: pMSCV
• Backbone size w/o insert (bp): 6910
• Total vector size (bp): 7657
• Vector type: Mammalian Expression, Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ArchT
• Alt name: archaerhodopsin TP009
• Species: Synthetic; H. strain TP009
• Insert Size (bp): 747
• GenBank ID: HM367071.1
• Promoter: Synapsin I (human)
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: TGTGGCTGGGAATCGGAACC
• 3′ sequencing primer: AACCAGTGGGGGTTGCGT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry