Skip to main content
Addgene

pGL4.23-MYC
(Plasmid #86461)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86461 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pGL4.23
  • Backbone manufacturer
    Promega
  • Backbone size (bp) 4500
  • Vector type
    Mammalian Expression, Luciferase
  • Promoter MYC

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin, 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer RVprimer3 CTAGCAAAATAGGCTGTCCC
  • 3′ sequencing primer L4440 AGCGAGTCAGTGAGCGAG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Use FspI and AclI to remove the kanamycin resistance cassette and replace with putative regulatory elements by Gibson cloning.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL4.23-MYC was a gift from Eric Lander (Addgene plasmid # 86461 ; http://n2t.net/addgene:86461 ; RRID:Addgene_86461)

  • For your References section:

    Systematic mapping of functional enhancer-promoter connections with CRISPR interference. Fulco CP, Munschauer M, Anyoha R, Munson G, Grossman SR, Perez EM, Kane M, Cleary B, Lander ES, Engreitz JM. Science. 2016 Sep 29. pii: aag2445. 10.1126/science.aag2445 PubMed 27708057
Related items:
Commonly requested with: