Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

ABCA1 promoter luciferase reporter (P2 fragment)
(Plasmid #86444)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86444 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGL4.10
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Human ABCA1
  • Species
    H. sapiens (human)
  • Entrez Gene
    ABCA1 (a.k.a. ABC-1, ABC1, CERP, HDLCQTL13, HDLDT1, HPALP1, TGD)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Kpn-I (not destroyed)
  • 3′ cloning site Bgl-II (not destroyed)
  • 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
  • 3′ sequencing primer GACGATAGTCATGCCCCGCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ABCA1 promoter luciferase reporter (P2 fragment) was a gift from David Mu (Addgene plasmid # 86444 ; http://n2t.net/addgene:86444 ; RRID:Addgene_86444)
  • For your References section:

    Thyroid transcription factor 1 enhances cellular statin sensitivity via perturbing cholesterol metabolism. Lai SC, Phelps CA, Short AM, Dutta SM, Mu D. Oncogene. 2018 Mar 19. pii: 10.1038/s41388-018-0174-7. doi: 10.1038/s41388-018-0174-7. 10.1038/s41388-018-0174-7 PubMed 29551766