-
PurposeHuman ABCA1 promoter luciferase reporter (Full-length)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86442 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGL4.10
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameABCA1 promoter
-
SpeciesH. sapiens (human)
-
Entrez GeneABCA1 (a.k.a. ABC-1, ABC1, CERP, HDLCQTL13, HDLDT1, HPALP1, TGD)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Kpn-I (not destroyed)
- 3′ cloning site Bgl-II (not destroyed)
- 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
- 3′ sequencing primer GACGATAGTCATGCCCCGCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ABCA1 promoter luciferase reporter (Full-length) was a gift from David Mu (Addgene plasmid # 86442 ; http://n2t.net/addgene:86442 ; RRID:Addgene_86442) -
For your References section:
Thyroid transcription factor 1 enhances cellular statin sensitivity via perturbing cholesterol metabolism. Lai SC, Phelps CA, Short AM, Dutta SM, Mu D. Oncogene. 2018 Mar 19. pii: 10.1038/s41388-018-0174-7. doi: 10.1038/s41388-018-0174-7. 10.1038/s41388-018-0174-7 PubMed 29551766