pKIR1.0
(Plasmid #86409)

• Purpose: CRISPR/Cas9 in Arabidopsis with seed a fluorescent reporter.
• Depositing Lab: Tetsuya Higashiyama
• Publication: Tsutsui et al Plant Cell Physiol. 2016 Nov 17. pii: pcw191.

Backbone

• Vector backbone: pFAST-R01
• Backbone manufacturer: Prof. Ikuko Hara-Nishimura
• Total vector size (bp): 17955
• Vector type: CRISPR
• Selectable markers: TagRFP in seeds

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: human-codon-optimized SpCas9
• Species: Streptococcus pyogenes
• Promoter: AtRPS5A
• Tags / Fusion Proteins:
  • FLAG (N terminal on insert)
  • NLS (N terminal on insert)
  • NLS (C terminal on insert)

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: atggactataaggaccacgac

Resource Information

• Supplemental Documents:
  • pKIR1.0.gb
• A portion of this plasmid was derived from a plasmid made by: human-codon-optimized SpCas9 was closed from pX330-U6-Chimeric_BB-CBh-hSpCas9 (item #42230) that we bought from Addgene on 6th June, 2013 by Prof. Tetsuya Higashiyama

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry