pAc5 HA3-eDHFR-T2A-puro
(Plasmid #86395)

• Purpose: for C-terminal tagging with eDHFR trimethoprim regulated degron with puro selection
• Depositing Lab: David Bentley
• Publication: Sheridan et al Biotechniques. 2016 Feb 1;60(2):69-74. doi: 10.2144/000114378. eCollection 2016 Feb.

Backbone

• Vector backbone: pAc5
• Vector type: CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: HA3 eDHFR T2A puro
• Species: E coli
• Mutation: R12Y, G67S and Y100I mutations in E coli DHFR
• Tag / Fusion Protein:
  • HA3 eDHFR T2A puro

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (destroyed during cloning)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: ggaggcggttacccatac
• 3′ sequencing primer: gtcgactgatcataatcagc

Resource Information

• Supplemental Documents:
  • annotated restriction map
• A portion of this plasmid was derived from a plasmid made by: The mutant E coli DHFR gene used in the two plasmids was derived from Cho et al PlosOne 8: e72393 Addgene plasmid 29325.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pAc5 HA3-eDHFR-T2A-puro was derived from pAc5gRNA Cas9 (Bassett, A.R.,et al Biol Open 3:42, 2014) by replacing the EcoRI-Hind III fragment encoding Cas9 with a PCR fragment encoding HA3-eDHFR amplified from pBMN DHFR(DD)-YFP (Iwamoto eet al Chem Biol 17:981, 2010.) (Addgene plasmid #29325)
This degron has R12Y, G67S and Y100I mutations in eDHFR