PX458_TEAD3_1
(Plasmid
#86337)
-
PurposeEncodes gRNA for 3' target of human TEAD3
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86337 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePX458
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA against TEAD3
-
gRNA/shRNA sequenceGCATCCTTAAGGAGGCGCAG
-
SpeciesH. sapiens (human)
-
Entrez GeneTEAD3 (a.k.a. DTEF-1, ETFR-1, TEAD-3, TEAD5, TEF-5, TEF5)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer pBR322ori-F (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: This plasmid is part of the Mendenhall and Meyers CRISPR-based Tagging system to add a tag (currently using FLAG) to endogenous proteins. Please see https://www.addgene.org/crispr/tagging/ for more details.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX458_TEAD3_1 was a gift from Eric Mendenhall & Richard M. Myers (Addgene plasmid # 86337 ; http://n2t.net/addgene:86337 ; RRID:Addgene_86337) -
For your References section:
CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Savic D, Partridge EC, Newberry KM, Smith SB, Meadows SK, Roberts BS, Mackiewicz M, Mendenhall EM, Myers RM. Genome Res. 2015 Sep 9. 10.1101/gr.193540.115 PubMed 26355004