pFETCh_TEAD1
(Plasmid #86291)

• Purpose: Donor vector for 3' FLAG tag of human TEAD1
• Depositing Labs: Eric Mendenhall, Richard M. Myers
• Publication: Savic et al Genome Res. 2015 Sep 9.

Backbone

• Vector backbone: pFETCh_Donor
• Vector type: CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TEAD1 homology arms
• Species: H. sapiens (human)
• Entrez Gene: TEAD1 (a.k.a. AA, NTEF-1, REF1, TCF-13, TCF13, TEAD-1, TEF-1)
• Tag / Fusion Protein:
  • 3XFLAG-P2A-NeoR (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: acgcctgtgaaaccgtacta
• 3′ sequencing primer: aactgttgggaagggcgatc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid was co-transfected along with PX458_TEAD1_1 into HepG2 cells, and genomic editing was verified by PCR. We performed ChIP-seq on this cell line using anti-FLAG Sigma F1804 and obtained data that passed our quality tests. Immunoprecipitation with anti-FLAG Sigma F1804 followed by mass spectrometry identified TEAD1. All released data, including ChIP-seq files and validation data, are available at the ENCODE web portal: https://www.encodeproject.org/search/?searchTerm=flag&type=Experiment&lab.title=Richard+Myers%2C+HAIB . Note: This plasmid is part of the Mendenhall and Meyers CRISPR-based Tagging system to add a tag (currently using FLAG) to endogenous proteins. Please see https://www.addgene.org/crispr/tagging/ for more details.