Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBbA5k-Maqu_0582
(Plasmid #86200)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86200 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBbA5k
  • Total vector size (bp) 9496
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Efflux pump
  • Insert Size (bp)
    5853
  • Promoter ATCGTTTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAAT

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGATCCAAACTCGAGTAAGG
  • 3′ sequencing primer GATCTTTTAAGAAGGAGATATACAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid carries D1044N in Maqu_0582 and M1I in Maqu_0583 compared to the genomic reference sequence. These mutations do not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBbA5k-Maqu_0582 was a gift from Mary Dunlop (Addgene plasmid # 86200 ; http://n2t.net/addgene:86200 ; RRID:Addgene_86200)
  • For your References section:

    Trade-Offs in Improving Biofuel Tolerance Using Combinations of Efflux Pumps. Turner WJ, Dunlop MJ. ACS Synth Biol. 2015 Oct 16;4(10):1056-63. doi: 10.1021/sb500307w. Epub 2014 Dec 12. 10.1021/sb500307w PubMed 25496359