Skip to main content
Addgene

pYPQ141-ZmUbi-RZ-As
(Plasmid #86196)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86196 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pYPQ141
  • Backbone manufacturer
    N/A
  • Vector type
    Plant Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AsCpf1 gRNA cloning site for ribozyme cleavage
  • gRNA/shRNA sequence
    gRNA scaffold only
  • Species
    Acidaminococcus sp. BV3L6
  • Promoter Maize ubiquitin 1
  • Tag / Fusion Protein
    • Hammerhead ribozyme and HDV ribozyme

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ttcccagtcacgacgttgtaaaac
  • 3′ sequencing primer catggtcatagctgtttcctg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYPQ141-ZmUbi-RZ-As was a gift from Yiping Qi (Addgene plasmid # 86196 ; http://n2t.net/addgene:86196 ; RRID:Addgene_86196)
  • For your References section:

    A CRISPR-Cpf1 system for efficient genome editing and transcriptional repression in plants. Tang X, Lowder LG, Zhang T, Malzahn AA, Zheng X, Voytas DF, Zhong Z, Chen Y, Ren Q, Li Q, Kirkland ER, Zhang Y, Qi Y. Nat Plants. 2017 Feb 17;3:17018. doi: 10.1038/nplants.2017.18. 10.1038/nplants.2017.18 PubMed 28211909