pTRE-Tight-BI-Gl NORM-LacZA-TER-LacZB
(Plasmid #86194)

• Purpose: beta Globin NMD construct with and without PTC under Bi-directional TET on promoter
• Depositing Lab: Robert Singer
• Publication: Trcek et al Genes Dev. 2013 Mar 1;27(5):541-51. doi: 10.1101/gad.209635.112. Epub 2013 Feb 21.

Backbone

• Vector backbone: pTRE-Tight BI
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 2800
• Total vector size (bp): 6048
• Vector type: Mammalian Expression ; Tet on

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: beta Globin
• Species: H. sapiens (human), M. musculus (mouse)
• Mutation: 39TER in beta Globin in MCS II
• Entrez Gene: HBB (a.k.a. CD113t-C, ECYT6, beta-globin)
• Entrez Gene: Hbb
• Promoter: Tet on

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SmaI (unknown if destroyed)
• 3′ cloning site: NheI (unknown if destroyed)
• 5′ sequencing primer: CCTGGAGATTTCGAGCTCGG
• 3′ sequencing primer: TAT TAC CGC CTT TGA GTG AGC TGA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry