pX459-sgPLXNB2
(Plasmid
#86151)
-
PurposeCas9/CRISPR plasmid for cut in human PLXNB2 gene exon 3
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86151 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX459
-
Backbone manufacturerFeng Zhang laboratory, MIT
- Backbone size w/o insert (bp) 9157
- Total vector size (bp) 9177
-
Vector typeCRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePlexin-B2
-
Alt namePLXNB2
-
gRNA/shRNA sequenceGTTCTCGGCGGCGACCGTCA
-
SpeciesH. sapiens (human)
-
Entrez GenePLXNB2 (a.k.a. MM1, Nbla00445, PLEXB2, dJ402G11.3)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer U6-fwd (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX459-sgPLXNB2 was a gift from Roland Friedel (Addgene plasmid # 86151 ; http://n2t.net/addgene:86151 ; RRID:Addgene_86151) -
For your References section:
Plexin-B2 facilitates glioblastoma infiltration by modulating cell biomechanics. Huang Y, Tejero R, Lee VK, Brusco C, Hannah T, Bertucci TB, Junqueira Alves C, Katsyv I, Kluge M, Foty R, Zhang B, Friedel CC, Dai G, Zou H, Friedel RH. Commun Biol. 2021 Jan 29;4(1):145. doi: 10.1038/s42003-021-01667-4. 10.1038/s42003-021-01667-4 PubMed 33514835