pMXs2-RAC1 G12V
(Plasmid #86139)

• Purpose: Retroviral vector expressing RAC1(G12V)-IRES-Bsd-p2A-RFP
• Depositing Lab: David Sabatini
• Publication: Wang et al Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013.

Backbone

• Vector backbone: pMXs2-IRES-Bsd-p2A-RFP
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RAC1
• Species: H. sapiens (human)
• Mutation: G12V
• Entrez Gene: RAC1 (a.k.a. MIG5, MRD48, Rac-1, TC-25, p21-Rac1)
• Promoter: LTR
• Tag / Fusion Protein:
  • 3xFLAG (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TACACGCCGCCCACGTGAAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

NOTE: GFP sequence present after the stop codon of the ORF that is not translated. RAC1 sequence is codon-optimized.

Addgene's sequencing results indicate a 3 base ambiguity in the blasticidin resistance gene. It is unclear if this sequence variant affects blasticidin resistance.