pThermeleon
(Plasmid
#86120)
-
PurposeBandpass temperature-gated expression of mWasabi and mCherry reporters
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86120 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepETDuet-1
-
Backbone manufacturerNovagen
-
Modifications to backboneReplaced pETDuet-1 T7 promoters and ORFs with: pR/pL and pLacI pTlpA
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameTlpA
-
SpeciesS. Typhimurium
-
Insert Size (bp)1116
-
MutationD341A
-
GenBank IDM88208.1
- Promoter pTlpA
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer atgcgtccggcgtaga
- 3′ sequencing primer ATCTTCATGTCGGGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemWasabi
-
SpeciesSynthetic
-
Insert Size (bp)756
-
GenBank IDEU024648.1
- Promoter pTlpA
-
Tag
/ Fusion Protein
- 6xHis (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer gttgcacacagctggaaaac
- 3′ sequencing primer CATCAGTGTATGGTGgcg (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameTcI38
-
Alt nameLambda Repressor
-
Insert Size (bp)714
-
MutationA67T, M1V, L65S, K68R, F115L, D126G, D188G
- Promoter pR/pL, pLacI
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer aagttggacatcacctcc
- 3′ sequencing primer ACTACTGGGCTGCTTCC (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert namemCherry
- Promoter pR/pL
-
Tag
/ Fusion Protein
- 6xHis (N terminal on insert)
Cloning Information for Gene/Insert 4
- Cloning method Gibson Cloning
- 5′ sequencing primer ACTGAGCACATCAGCAGG
- 3′ sequencing primer ggaggtgatgtccaactt (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert namecI
-
Alt nameLambda Repressor
-
SpeciesBacteriophage Lambda
-
Insert Size (bp)714
- Promoter pTlpA
Cloning Information for Gene/Insert 5
- Cloning method Gibson Cloning
- 5′ sequencing primer ACCGTTTACGAGATC
- 3′ sequencing primer CCGCTACAGGGCGCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pThermeleon was a gift from Mikhail Shapiro (Addgene plasmid # 86120 ; http://n2t.net/addgene:86120 ; RRID:Addgene_86120) -
For your References section:
Tunable thermal bioswitches for in vivo control of microbial therapeutics. Piraner DI, Abedi MH, Moser BA, Lee-Gosselin A, Shapiro MG. Nat Chem Biol. 2017 Jan;13(1):75-80. doi: 10.1038/nchembio.2233. Epub 2016 Nov 14. 10.1038/nchembio.2233 PubMed 27842069