Skip to main content

pTcI42-Wasabi
(Plasmid #86118)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86118 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pETDuet-1
  • Backbone manufacturer
    Novagen
  • Modifications to backbone
    Replaced T7 Promoter #1 with pR/pL Promoter. Replaced T7 Promoter #2 with LacI Promoter.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    TcI42
  • Alt name
    Lambda Repressor
  • Species
    Bacteriophage Lambda
  • Insert Size (bp)
    714
  • Mutation
    A67T, K6N, S33T, Y61H, L119P, F122C
  • Promoter pR/pL, LacI

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer gcttgcggccgcataa
  • 3′ sequencing primer CTAGTTATTGCTCAGCGGTG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mWasabi
  • Insert Size (bp)
    756
  • GenBank ID
    EU024648.1
  • Promoter pR/pL
  • Tag / Fusion Protein
    • 6xHis (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (destroyed during cloning)
  • 5′ sequencing primer ATGCGTCCGGCGTAGA
  • 3′ sequencing primer ttatgcggccgcaagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTcI42-Wasabi was a gift from Mikhail Shapiro (Addgene plasmid # 86118 ; http://n2t.net/addgene:86118 ; RRID:Addgene_86118)
  • For your References section:

    Tunable thermal bioswitches for in vivo control of microbial therapeutics. Piraner DI, Abedi MH, Moser BA, Lee-Gosselin A, Shapiro MG. Nat Chem Biol. 2017 Jan;13(1):75-80. doi: 10.1038/nchembio.2233. Epub 2016 Nov 14. 10.1038/nchembio.2233 PubMed 27842069