pTlpA-Wasabi-NF
(Plasmid
#86100)
-
PurposeNonfluorescent variant of mWasabi reporter gene gated by wild type TlpA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86100 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepETDuet-1
-
Backbone manufacturerNovagen
-
Modifications to backboneReplaced T7 Promoter #1 with TlpA Promoter. Replaced T7 Promoter #2 with LacI Promoter.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameTlpA
-
SpeciesS. Typhimurium
-
Insert Size (bp)1116
-
MutationD341A
-
GenBank IDM88208.1
- Promoter TlpA, LacI
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer gcttgcggccgcataa
- 3′ sequencing primer CTAGTTATTGCTCAGCGGTG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemWasabi
-
Insert Size (bp)756
-
MutationS71T, G73A
-
GenBank IDEU024648.1
- Promoter TlpA
-
Tag
/ Fusion Protein
- 6xHis (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ATGCGTCCGGCGTAGA
- 3′ sequencing primer ttatgcggccgcaagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDr. B. Brett Finlay at the University of British Columbia.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTlpA-Wasabi-NF was a gift from Mikhail Shapiro (Addgene plasmid # 86100 ; http://n2t.net/addgene:86100 ; RRID:Addgene_86100) -
For your References section:
Tunable thermal bioswitches for in vivo control of microbial therapeutics. Piraner DI, Abedi MH, Moser BA, Lee-Gosselin A, Shapiro MG. Nat Chem Biol. 2017 Jan;13(1):75-80. doi: 10.1038/nchembio.2233. Epub 2016 Nov 14. 10.1038/nchembio.2233 PubMed 27842069