pCMV-SPORT6-hHMGCR1
(Plasmid #86085)

• Purpose: expresses the human HMG-CoA reductase isoform 1
• Depositing Lab: Anne Galy
• Publication: Genethon pCMV-SPORT6-hHMGCR1 plasmid (unpublished)

Backbone

• Vector backbone: pCMV-SPORT6-hHMGCR2
• Backbone manufacturer: I.M.A.G.E consortium (Library NIH_MGC_118, Image Id 5212903)
• Backbone size w/o insert (bp): 5639
• Total vector size (bp): 8305
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human HMG-CoA Reductase isoform 1
• Species: H. sapiens (human)
• Insert Size (bp): 2666
• GenBank ID: NM_000859.2
• Entrez Gene: HMGCR (a.k.a. LDLCQ3, LGMDR28, MYPLG)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BstBI (not destroyed)
• 3′ cloning site: PvuII (not destroyed)
• 5′ sequencing primer: ccggactctagcctaggccg
• 3′ sequencing primer: tcctttagaacccaatgccc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: the I.M.A.G.E consortium (pCMV-SPORT6-hHMGCR2, Library NIH_MGC_118, Image Id 5212903),
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The pCMV-SPORT6-hHMGCR1 plasmid was obtained by inserting a fragment of human HMGCR1 in the pCMV-SPORT6-hHMGCR2 plasmid (Library NIH_MGC_118, Image Id 5212903) using BstBI and PvuII unique restriction sites.

Addgene note: This plasmid also contains a portion of the 3' UTR of HMCGR1.