GST-Rab8a-TN
(Plasmid #86080)

• Purpose: A bacterial expression plasmid encoding GDP locked Rab8a (Rab8a-T22N) with N-terminus GST.
• Depositing Lab: Lei Lu
• Publication: Madugula et al J Cell Sci. 2016 Oct 15;129(20):3922-3934. Epub 2016 Sep 15.

Backbone

• Vector backbone: pGEB
• Backbone manufacturer: Lu Lei (J Cell Sci. 2001)
• Backbone size w/o insert (bp): 5000
• Total vector size (bp): 5617
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: hRab8A
• Alt name: ras-related protein Rab-8A
• Species: H. sapiens (human)
• Mutation: Changed threonine 22 to aspargine
• GenBank ID: NM_005370.4
• Entrez Gene: RAB8A (a.k.a. MEL, RAB8)
• Promoter: tac
• Tag / Fusion Protein:
  • GST (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: 5' GGCAAGCCACGTTTGGTG 3'
• 3′ sequencing primer: 5' GGAGCTGCATGTGTCAGAGG 3'

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The original Rab8a clone was from Mammalian Gene Collection (IMAGE:3547214)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry