Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

GST-RP2
(Plasmid #86072)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86072 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGEX-4T1
  • Backbone manufacturer
    GE Healthcare
  • Backbone size w/o insert (bp) 4969
  • Total vector size (bp) 6015
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    RP2
  • Alt name
    retinitis pigmentosa 2
  • Species
    H. sapiens (human)
  • Entrez Gene
    RP2 (a.k.a. DELXp11.3, NM23-H10, NME10, TBCCD2, XRP2)
  • Promoter tac
  • Tag / Fusion Protein
    • GST (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer 5' GGCAAGCCACGTTTGGTG 3'
  • 3′ sequencing primer 5' GGAGCTGCATGTGTCAGAGG 3'
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The original RP2 gene was from addgene, clone pDONR223-RP2 (Plasmid #23636)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GST-RP2 was a gift from Lei Lu (Addgene plasmid # 86072 ; http://n2t.net/addgene:86072 ; RRID:Addgene_86072)
  • For your References section:

    A ternary complex comprising transportin1, Rab8 and the ciliary targeting signal directs proteins to ciliary membranes. Madugula V, Lu L. J Cell Sci. 2016 Oct 15;129(20):3922-3934. Epub 2016 Sep 15. 10.1242/jcs.194019 PubMed 27633000